Chapter 28 – Review

28.1 Carbohydrates

  1. Which compounds would be classified as carbohydrates? Check answer[1]
    Various structures used to determine which are carbohydrates. a) molecule contains an aldehyde functional group with OH groups on the other two carbon atoms; b) only OH groups present on the molecule; c) molecule contains a ketone functional group with OH groups on the other two carbon atoms; d) this molecule has a ketone functional group, one of the other carbons atoms does not have an OH group attached.
    (credit: Intro Chem: GOB (V. 1.0).CC BY-NC-SA 3.0).
  1. Which compounds would be classified as carbohydrates? Check answer[2]
    4 structures used to determine whether they represent a carbohydrate. a)molecule has a ketone functional group, one of the other carbons atoms does not have an OH group attached; b) molecule contains an aldehyde functional group with OH groups on the other two carbon atoms; c) molecule contains a ketone functional group with OH groups on the other two carbon atoms; d) molecule only contains OH groups and does not contain an aldehyde group, nor does it contain a ketone group.
    (credit: Intro Chem: GOB (V. 1.0).CC BY-NC-SA 3.0).

28.2 Lipids

  1. The melting point of elaidic acid is 52°C.
    1. What trend is observed when comparing the melting points of elaidic acid, oleic acid, and stearic acid? Explain.Check answer[3]
    2. Would you expect the melting point of palmitelaidic acid to be lower or higher than that of elaidic acid? Explain. Check answer[4]
  2. Examine the labels on two brands of margarine and two brands of shortening and list the oils used in the various brands.

  3. In cerebrosides (Figure 28.2s), is the linkage between the fatty acid and sphingosine an amide bond or an ester bond? Justify your answer.
  4. Explain whether each compound would be expected to diffuse through the lipid bilayer of a cell membrane.
    1. potassium chloride
    2. CH3CH2CH2CH2CH2CH3
    3. fructose
  5. Identify the role of each steroid hormone in the body.
    1. progesterone Check answer[5]
    2. aldosterone Check answer[6]
    3. testosterone Check answer[7]
    4. cortisol Check answer[8]
  6. What fatty acid is the precursor for the prostaglandins? Check answer[9]
  7. Identify three biological effects of prostaglandins. Check answer[10]
  8. Why is it important to determine the ratio of LDLs to HDLs, rather than just the concentration of serum cholesterol?

28.3 Amino Acids, Proteins, and Enzymes

  1. What is the general structure of an α-amino acid? Check answer[11]
  2. Identify the amino acid that fits each description.
    1. also known as aspartate Check answer[12]
    2. almost as strong a base as sodium hydroxide Check answer[13]
    3. does not have a chiral carbon Check answer[14]
  3. Write the side chain of each amino acid.
    1. serine Check answer[15]
    2. arginine Check answer[16]
    3. phenylalanine Check answer[17]
  4. Write the side chain of each amino acid.
    1. aspartic acid Check answer[18]
    2. methionine Check answer[19]
    3. valine Check answer[20]
  5. Identify an amino acid whose side chain contains a(n)
    1. amide functional group.
    2. aromatic ring.
    3. carboxyl group.
  6. Identify an amino acid whose side chain contains a(n)
    1. OH group
    2. branched chain
    3. amino group
  7. Define each term.
    1. zwitterion Check answer[21]
    2. isoelectric point Check answer[22]
  8. Draw the structure for the anion formed when alanine (at neutral pH) reacts with a base. Check answer[23]
  9. Draw the structure for the cation formed when alanine (at neutral pH) reacts with an acid. Check answer[24]
  10. Distinguish between the N-terminal amino acid and the C-terminal amino acid of a peptide or protein. Check answer[25]
  11. Describe the difference between an amino acid and a peptide. Check answer[26]
  12. Amino acid units in a protein are connected by peptide bonds. What is another name for the functional group linking the amino acids? Check answer[27]
  13. Draw the structure for each peptide.
    1. gly-val Check answer[28]
    2. val-gly Check answer[29]
  14. Identify the C- and N-terminal amino acids for the peptide lys-val-phe-gly-arg-cys. Check answer[30]
  15. Identify the C- and N-terminal amino acids for the peptide asp-arg-val-tyr-ile-his-pro-phe.
  16. What is the predominant attractive force that stabilizes the formation of secondary structure in proteins? Check answer[31]
  17. Distinguish between the tertiary and quaternary levels of protein structure. Check answer[32]
  18. Briefly describe four ways in which a protein could be denatured. Check answer[33]
  19. What name is given to the predominant secondary structure found in silk? Check answer[34]
  20. What name is given to the predominant secondary structure found in wool protein?
  21. A protein has a tertiary structure formed by interactions between the side chains of the following pairs of amino acids. For each pair, identify the strongest type of interaction between these amino acids.
    1. aspartic acid and lysine Check answer[35]
    2. phenylalanine and alanine Check answer[36]
    3. serine and lysine Check answer[37]
    4. two cysteines Check answer[38]
  22. What level(s) of protein structure is(are) ordinarily disrupted in denaturation? What level(s) is(are) not? Check answer[39]
  23. Distinguish between the lock-and-key model and induced-fit model of enzyme action. Check answer[40]

28.4 Nucleic Acids and DNA

  1. Name the two kinds of nucleic acids. Check answer[41]
  2. Which type of nucleic acid stores genetic information in the cell? Check answer[42]
  3. What are complementary bases? Check answer[43]
  4. Why is it structurally important that a purine base always pair with a pyrimidine base in the DNA double helix? Check answer[44]
  5. For this short RNA segment,
    1. identify the 5′ end and the 3′ end of the molecule.
    2. circle the atoms that comprise the backbone of the nucleic acid chain.
    3. write the nucleotide sequence of this RNA segment.

      Check answer[45]

  6. For this short DNA segment,
    1. identify the 5′ end and the 3′ end of the molecule.
    2. circle the atoms that comprise the backbone of the nucleic acid chain
    3. write the nucleotide sequence of this DNA segment.
      the nucleotide sequence of a DNA segment
      (credit: Intro Chem: GOB (V. 1.0).CC BY-NC-SA 3.0).
  7. Which nitrogenous base in DNA pairs with each nitrogenous base?
    1. cytosine Check answer[46]
    2. adenine Check answer[47]
    3. guanine Check answer[48]
    4. thymine Check answer[49]
  8. Which nitrogenous base in RNA pairs with each nitrogenous base?
    1. cytosine
    2. adenine
    3. guanine
    4. thymine
  9. How many hydrogen bonds can form between the two strands in the short DNA segment shown below?
    5′ ATGCGACTA 3′ 3′ TACGCTGAT 5′ Check answer[50]
  10. How many hydrogen bonds can form between the two strands in the short DNA segment shown below?
    5′ CGATGAGCC 3′ 3′ GCTACTCGG 5′
  11. Identify the three molecules needed to form the nucleotides in each nucleic acid.
    1. DNA Check answer[51]
    2. RNA Check answer[52]
  12. Classify each compound as a pentose sugar, a purine, or a pyrimidine.
    1. adenine Check answer[53]
    2. guanine Check answer[54]
    3. deoxyribose Check answer[55]
    4. thymine Check answer[56]
    5. ribose Check answer[57]
    6. cytosine Check answer[58]
  13. What is the sugar unit in each nucleic acid?
    1. RNA Check answer[59]
    2. DNA Check answer[60]
  14. For each structure, circle the sugar unit and identify the nucleotide as a ribonucleotide or a deoxyribonucleotide. Check answer[61]
    Two structures: a) shows the deoxyribonucleotide portion and b) shows the ribonucleotide portion
    (credit: Intro Chem: GOB (V. 1.0).CC BY-NC-SA 3.0).
  15. For each structure, circle the nitrogenous base and identify it as a purine or pyrimidine. Check answer[62]
    Two structures: a) shows the purine portion and b) shows the pyrimidine portion
    (credit: Intro Chem: GOB (V. 1.0).CC BY-NC-SA 3.0).
  16. In DNA replication, a parent DNA molecule produces two daughter molecules. What is the fate of each strand of the parent DNA double helix? Check answer[63]
  17. What is the role of DNA in transcription? What is produced in transcription? Check answer[64]
  18. Describe how replication and transcription are similar. Check answer[65]
  19. Describe how replication and transcription differ.
  20. A portion of the coding strand for a given gene has the sequence 5′‑ATGAGCGACTTTGCGGGATTA‑3′.
    1. What is the sequence of complementary template strand? Check answer[66]
    2. What is the sequence of the mRNA that would be produced during transcription from this segment of DNA?Check answer[67]
  21. A portion of the coding strand for a given gene has the sequence 5′‑ATGGCAATCCTCAAACGCTGT‑3′.
    1. What is the sequence of complementary template strand?
    2. What is the sequence of the mRNA that would be produced during transcription from this segment of DNA?
  22. What are the roles of mRNA and tRNA in protein synthesis? Check answer[68]
  23. What is the initiation codon? Check answer[69]
  24. What are the termination codons and how are they recognized? Check answer[70]
  25. Write the anticodon on tRNA that would pair with each mRNA codon.
    1. 5′‑UUU‑3′ Check answer[71]
    2. 5′‑CAU‑3′ Check answer[72]
    3. 5′‑AGC‑3′ Check answer[73]
    4. 5′‑CCG‑3′ Check answer[74]
  26. Write the codon on mRNA that would pair with each tRNA anticodon.
    1. 5′‑UUG‑3′
    2. 5′‑GAA‑3′
    3. 5′‑UCC‑3′
    4. 5′‑CAC‑3′
  27. The peptide hormone oxytocin contains 9 amino acid units. What is the minimum number of nucleotides needed to code for this peptide? Check answer[75]
  28. Myoglobin, a protein that stores oxygen in muscle cells, has been purified from a number of organisms. The protein from a sperm whale is composed of 153 amino acid units. What is the minimum number of nucleotides that must be present in the mRNA that codes for this protein?
  29. Use Figure 28.4r to determine the amino acid sequence produced from this mRNA sequence: 5′‑AUGAGCGACUUUGCGGGAUUA‑3′. Check answer[76]
  30. Use Figure 28.4r to determine the amino acid sequence produced from this mRNA sequence: 5′‑AUGGCAAUCCUCAAACGCUGU‑3′
  31. What effect can UV radiation have on DNA? Check answer[77]
  32. What causes PKU? Check answer[78]
  33. How is PKU detected and treated? Check answer[79]
  34. A portion of the coding strand of a gene was found to have the sequence 5′‑ATGAGCGACTTTCGCCCATTA‑3′. A mutation occurred in the gene, making the sequence 5′‑ATGAGCGACCTTCGCCCATTA‑3′.
    1. Identify the mutation as a substitution, an insertion, or a deletion. Check answer[80]
    2. What effect would the mutation have on the amino acid sequence of the protein obtained from this mutated gene? Check answer[81]
  35. A portion of the coding strand of a gene was found to have the sequence 5′‑ATGGCAATCCTCAAACGCTGT‑3′. A mutation occurred in the gene, making the sequence 5′‑ATGGCAATCCTCAACGCTGT‑3′.
    1. Identify the mutation as a substitution, an insertion, or a deletion.
    2. What effect would the mutation have on the amino acid sequence of the protein obtained from this mutated gene?
  36. What is a mutagen? Check answer[82]
  37. Give two examples of mutagens. Check answer[83]
28.5 Vitamins
  1. Identify each vitamin as water soluble or fat soluble. a) vitamin D b) vitamin C c) vitamin B12 Check answer[84]
  2. Identify each vitamin as water soluble or fat soluble. a) niacin b) cholecalciferol c) biotin
  3. What is the function of each vitamin? a) vitamin A b) biotin c) vitamin K Check answer[85]

Attribution & References

Except where otherwise noted, this page (including images in solutions) is adapted by Gregory A. Anderson and Samantha Sullivan Sauer from


  1. a. This is a carbohydrate because the molecule contains an aldehyde functional group with OH groups on the other two carbon atoms. b. This is not a carbohydrate because the molecule does not contain an aldehyde or a ketone functional group. c. This is a carbohydrate because the molecule contains a ketone functional group with OH groups on the other two carbon atoms. d. This is not a carbohydrate; although it has a ketone functional group, one of the other carbons atoms does not have an OH group attached.
  2. a. This is not a carbohydrate; although it has a ketone functional group, one of the other carbons atoms does not have an OH group attached. b. This is a carbohydrate because the molecule contains an aldehyde functional group with OH groups on the other two carbon atoms. c. This is a carbohydrate because the molecule contains a ketone functional group with OH groups on the other two carbon atoms. d. This is not a carbohydrate; it does not contain an aldehyde group, nor does it contain a ketone group.
  3. Stearic acid has the highest melting point, followed by elaidic acid, and then oleic acid with the lowest melting point. Elaidic acid is a trans fatty acid, and the carbon chains can pack together almost as tightly as those of the saturated stearic acid. Oleic acid is a cis fatty acid, and the bend in the hydrocarbon chain keeps these carbon chains from packing as closely together; fewer interactions lead to a much lower melting point.
  4. The melting point of palmitelaidic acid should be lower than that of elaidic acid because it has a shorter carbon chain (16, as compared to 18 for elaidic acid). The shorter the carbon chain, the lower the melting point due to a decrease in intermolecular interactions.
  5. regulates the menstrual cycle and maintains pregnancy
  6. regulates salt metabolism by stimulating the kidneys to retain sodium and excrete potassium
  7. stimulates and maintains male sex characteristics
  8. stimulates the conversion of proteins to carbohydrates
  9. arachidonic acid
  10. induce smooth muscle contraction, lower blood pressure, and contribute to the inflammatory response
  11. the structure of an α-amino acid
  12. aspartic acid
  13. arginine
  14. glycine
  15. CH2OH
  16. 3 amine groups attached to a carbon
  17. a methyl phenyl group
  18. a CH group is centered around a positive amine group, a methyl group and a COO- group
  19. CH is centered around a positive amine group, methyl thiol group and a COO- group.
  20. CH centered around a positive amine group, a methyl substituted cycloamine group and a COO- group
  21. an electrically neutral compound that contains both negatively and positively charged groups
  22. the pH at which a given amino acid exists in solution as a zwitterion
  23. CH centered around a positive amine group, a methyl group and a COO- group
  24. CH centered around a positive amine group, a methyl group and a carboxylic acid (COOH) group
  25. The N-terminal end is the end of a peptide or protein whose amino group is free (not involved in the formation of a peptide bond), while the C-terminal end has a free carboxyl group.
  26. A peptide is composed of two or more amino acids. Amino acids are the building blocks of peptides.
  27. amide bond
  28. Structure of gly-val peptide
  29. Structure of val-gly peptide
  30. C-terminal amino acid: cys; N-terminal amino acid: lys
  31. hydrogen bonding
  32. Tertiary structure refers to the unique three-dimensional shape of a single polypeptide chain, while quaternary structure describes the interaction between multiple polypeptide chains for proteins that have more than one polypeptide chain.
  33. (1) heat a protein above 50°C or expose it to UV radiation; (2) add organic solvents, such as ethyl alcohol, to a protein solution; (3) add salts of heavy metal ions, such as mercury, silver, or lead; and (4) add alkaloid reagents such as tannic acid
  34. β-pleated sheet
  35. ionic bonding
  36. dispersion forces
  37. dispersion forces
  38. disulfide linkage
  39. Protein denaturation disrupts the secondary, tertiary, and quaternary levels of structure. Only primary structure is unaffected by denaturation.
  40. The lock-and-key model portrays an enzyme as conformationally rigid and able to bond only to substrates that exactly fit the active site. The induced fit model portrays the enzyme structure as more flexible and is complementary to the substrate only after the substrate is bound.
  41. deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)
  42. DNA
  43. the specific base pairings in the DNA double helix in which guanine is paired with cytosine and adenine is paired with thymine
  44. The width of the DNA double helix is kept at a constant width, rather than narrowing (if two pyrimidines were across from each other) or widening (if two purines were across from each other).
  45. ACU

    an RNA segment showing the 5 prime and 3 prime ends
  46. guanine
  47. thymine
  48. cytosine
  49. adenine
  50. 22 (2 between each AT base pair and 3 between each GC base pair)
  51. nitrogenous base (adenine, guanine, cytosine, and thymine), 2-deoxyribose, and H3PO4
  52. nitrogenous base (adenine, guanine, cytosine, and uracil), ribose, and H3PO4
  53. purine
  54. purine
  55. pentose sugar
  56. pyrimidine
  57. pentose sugar
  58. pyrimidine
  59. ribose
  60. deoxyribose
  61. Two structures: a) shows the deoxyribonucleotide portion and b) shows the ribonucleotide portion
  62. Two structures: a) shows the purine portion and b) shows the pyrimidine portion
  63. Each strand of the parent DNA double helix remains associated with the newly synthesized DNA strand.
  64. DNA serves as a template for the synthesis of an RNA strand (the product of transcription).
  65. Both processes require a template from which a complementary strand is synthesized.
  66. 3′‑TACTCGCTGAAACGCCCTAAT‑5′
  67. 5′‑AUGAGCGACUUUGCGGGAUUA‑3′
  68. mRNA provides the code that determines the order of amino acids in the protein; tRNA transports the amino acids to the ribosome to incorporate into the growing protein chain.
  69. AUG
  70. UAA, UAG, and UGA; they are recognized by special proteins called release factors, which signal the end of the translation process.
  71. 3′‑AAA‑5′
  72. 3′‑GUA‑5′
  73. 3′‑UCG‑5′
  74. 3′‑GGC‑5′
  75. 27 nucleotides (3 nucleotides/codon)
  76. met-ser-asp-phe-ala-gly-leu
  77. It can lead to the formation of a covalent bond between two adjacent thymines on a DNA strand, producing a thymine dimer.
  78. the absence of the enzyme phenylalanine hydroxylase
  79. PKU is diagnosed by assaying a sample of blood or urine for phenylalanine or one of its metabolites; treatment calls for an individual to be placed on a diet containing little or no phenylalanine.
  80. substitution
  81. Phenylalanine (UUU) would be replaced with leucine (CUU).
  82. a chemical or physical agent that can cause a mutation
  83. UV radiation and gamma radiation (answers will vary)
  84. a) fat soluble, b) water soluble, c) water soluble
  85. a) needed for the formation of vision pigments, b) needed for cell growth and metabolism c) needed for blood clotting

License

Icon for the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License

Organic and Biochemistry Supplement to Enhanced Introductory College Chemistry Copyright © 2024 by Gregory Anderson; Caryn Fahey; Adrienne Richards; Samantha Sullivan Sauer; David Wegman; and Jen Booth is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License, except where otherwise noted.